7 access and display cue points embedded in a video file
Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium
... Orissa (India) from 1982-2004 and presently working as the Head of the faculty of Physics in KBDAV College, Nirakarpur, Orissa (India) since 2004 He has 27 years of teaching experience and 10 years ... field near the plate upto a certain distance and thereafter the flow behaviour reverses An increase in suction parameter/Reynolds number increases the temperature of the flow field at all points ... of mass transfer effects on unsteady flow past an accelerated vertical porous plate with suction Bull Malays Math Sci Soc 2006, 29(1), 33-42 [15] Das S S., Satapathy A. , Das J K., Panda J P Mass...
- 12
- 493
- 0
Báo cáo y học: "Distribution of airway narrowing responses across generations and at branching points, assessed in vitro by anatomical optical coherence tomography" docx
... data points available for each individual airway (Pearson’s correlation analysis) Figure Airway narrowing measured in the most distal and proximal airways within the bronchial airway preparation ... establishing both a spatial and temporal relationship of response The isolated airway preparation was free of parenchymal attachments and had a standardized transmural pressure (pre and afterload) and ... administration as a non repeat measure variable, and anatomical location as a repeat measure variable Linear correlations between maximum narrowing and time to 50% narrowing were computed using...
- 12
- 297
- 0
Diatom and geochemical indicators of acidification in a tropical forest stream, singapore 7
... assemblage at this depth points to an acidic environment, but with a higher abundance of taxa present in less acidic waters (Eunotia vanheurckii, Eunotia curvata and Fragilaria bicapitata), and a ... Eunotia vanheurckii, Eunotia curvata and Fragilaria bicapitata dropping and levels of Eunotia incisa and Eunotia flexuosa rising This implies that the stream is becoming more acidic During the ... lower abundance of taxa present in more acidic waters (Eunotia incisa and Eunotia flexuosa) Trace metal concentration begin increasing up-core and peak at 15cm This could be due to changing catchment...
- 7
- 131
- 0
Process evaluation and treatability study of wastewater in a textile dyeing industry
... Tolerance limits for industrial effluents discharged into inland surface water, Indian Standards on Water Pollution, BIS, New Delhi, India Debabrata Mazumder was graduated in the year 1993 with Bachelor ... COD and Alkalinity A composite wastewater sample was subjected to treatability study by means of coagulation-flocculation with alum and chemical oxidation with bleaching powder [Ca(OCl)2] separately ... fabric dyeing and characterized for the relevant parameters A composite wastewater sample was prepared by mixing Jute and Cotton fabric dyeing wastewater according to their discharge ratio i.e...
- 14
- 534
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained by Mosetti [1] who obtained a somewhat random arrangement ... University in St Louis He received B.S in Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's...
- 12
- 635
- 1
Tài liệu COMMUNICATION FROM THE COMMISSION TO THE COUNCIL AND THE EUROPEAN PARLIAMENT Innovation in a knowledge-driven economy ppt
... States and sectors as a means of comparing best practice, – Translating these European guidelines into national and regional policies by setting specific targets and adopting measures, taking into ... legal, fiscal and financial environment favourable to the creation and development of start-ups The interface between companies and financial markets requires attention since financial constraints, ... be appreciated The media are important as a source of information on progress in research and innovation: they also draw attention to the balance of advantage and disadvantage We need to make...
- 32
- 502
- 0
Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc
... For information about building Connection Manager profiles that automatically install certificates and certificate chains for the user, see Network Access Quarantine Control in Related Links ... for dial-up access, install Connection Manager Administration Kit and Phone Book Administrator on VPN1 Additionally, create a phone book and post it to the phone book server, and create a dial-up ... Domain box and to automatically append the domain name to the user name If you type a domain name in User name, the domain name will be appended twice, which will cause problems with accessing...
- 59
- 1,146
- 0
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt
... University of Illinois and a German Academic Exchange Service (DAAD) Graduate Research Grant Julia Hockenmaier is supported by the National Science Foundation through CAREER award 1053856 and award 0803603 ... Hock and Brian D Joseph 1996 Language history, language change, and language relationship: An introduction to historical and comparative linguistics Berlin, New York: Mouton de Gruyter Andrew Kachites ... train a maximum entropy classifier, using character 1- through 6-grams (including word boundaries) as features Since we could not manually annotate a large portion of the MZEE corpus, the training...
- 5
- 537
- 0
The working families’ tax credit and some European tax reforms in a collective setting pdf
... Economic and Social Research Council is greatly appreciated The usual disclaimer applies Appendix A Personal income taxation in the UK Table A1 Income tax and National Insurance in 1998/99 Income tax ... between his and her investment/savings income, and on a vector of other characteristics Living in London and having a child aged negatively in uences the male bar gaining position Men who are better ... revenue neutral linear tax reform is characterized by a unique tax rate of 44% and a minimum guaranteed income of 3,000 euro for a single individual and 3,200 euro for each spouse in a married couple...
- 30
- 304
- 0
Long-term Exposure to Traffic-related Air Pollution and Type 2 Diabetes Prevalence in a Cross-sectional Screening-study in the Netherlands pdf
... all national, provincial and municipal authorities in the study area and were linked to a digital map of all roads in the Netherlands (NWB), using GIS Other land use data were obtained from a ... conducted using ArcInfo (ESRI, Redlands, CA) Statistical analyses Participants with missing values on exposure variables and the covariates age, gender and income were excluded from all analyses We ... to work in the area of Amsterdam, around 60 km away No freeways are present in the study area Two highways, known as provincial roads in the Netherlands, with a traffic flow of approximately 15,000...
- 9
- 771
- 0
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx
... Physicians in a Tertiary Care Hospital Doctor’s Initials: Age: Sex: Specialty: male female General Practitioner Pulmonary Internal Medicine Infectious Disease Year graduated from Medical School: ... Diagnostic standards and classification of tuberculosis in adults and children Am J Respir Crit Care Med 2000; 161: 1376-1395 Manalo MFC, Pineda AV, Montoya JC Knowledge, attitudes and practices for ... physicians' approach in the diagnosis and management of pulmonary tuberculosis To determine if there are deviations from the guidelines in TB management MATERIALS AND METHODS The study was conducted in...
- 10
- 517
- 1
Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx
... M A Walker, D J Litman, C A Kamm, and A Abella 1997 PARADISE: A framework for evaluating spoken dialogue agents In Proceedings of ACL/EACL 1997 ACL Anthology P971035 K Papineni, S Roukos, T Ward, ... conversational agent In Proceedings of INLG 2008 ACL Anthology W08-1113 M E Foster, M Giuliani, A Isard, C Matheson, J Oberlander, and A Knoll 2009 Evaluating description and reference strategies in ... in a cooperative human-robot dialogue system In Proceedings of IJCAI 2009 M Huber, M Rickert, A Knoll, T Brandt, and S Glasauer 2008 Human-robot interaction in handing-over tasks In Proceedings...
- 9
- 310
- 0
Factors affecting delays in diagnosis and treatment of pulmonary tuberculosis in a tertiary care hospital in Istanbul, Turkey pptx
... Med, 1992; 117: 251-53 24 Yamasaki-Nakagawa M, Ozasa K, Yamada N et al: Gender difference in delays to diagnosis and health care seeking behaviour in a rural area of Nepal Int J Tuberc Lung Dis, ... delays included patient delay, institutional delay, diagnostic delay, and delay in the treatment Both patient and institutional delays result in increased infection risk for the population Diagnostic ... longer patient delay in patients aged 45 years and over and in rural patients [12] However, Liam et al showed that sex [21], age, education level, and initial symptom had no significant association...
- 6
- 466
- 0
Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx
... Higashinaka, M Nakano, and K Aikawa 2003 Corpus-based discourse understanding in spoken dialogue systems In ACL-03, Sapporo, Japan Visualization Tool E Levin, R Pieraccini, and W Eckert 2000 A stochastic ... All data is continuously stored in a database which web-service based processing modules (such as SLU, DM and language generation) access This architecture also allows us to access the database ... mines the where au,t+1 is the true user action Rule-based Dialogue Management A rule-based dialogue manager was developed as a meaningful comparison to the trained DM, to obtain training data...
- 4
- 269
- 0
Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt
... kb DNA fragment, containing the sequence encoding the ectodomain of gp41 of HIV isolate LAI (amino acids 537–669), was obtained by PCR amplification using, as template, a plasmid containing the ... 5¢-CTCTTTCATGACGCTGACGGTA CAGGCC-3¢; reverse primer: 5¢-CCGCTCGAGCTAATG GTGATGGTGATGGTGTGACCCTCCCCCTCCACT TGCCCATTTATCTAA-3¢ The start codon in the forward primer (in bold) is a naturally occurring ... urea, 500 mM NaCl, 10 mM imidazole, pH 8.0) and agitated at °C for 30 After filtration using a 0.45 lm cut-off filter, protein was loaded onto a ml Hi-Trap Chelating column (Amersham Pharmacia Biotech),...
- 14
- 375
- 0
Báo cáo hóa học: "Evaluation, diagnosis, and treatment of lead poisoning in a patient with occupational lead exposure: a case presentation" pptx
... smoked in the working place, which was having poor housekeeping practices and minimum engineering control, lacking local and general exhaust ventilation and washing facilities culminating into alarmingly ... synthesis and elevated levels of the precursor δ-aminolevulinic acid (ALA), which is a weak gamma-aminobutyric acid (GABA) agonist that decreases GABA release by presynaptic inhibition [6,7] Lead is ... clothes and no separate areas were provided for the removal and storage of the lead-contaminated protective work clothing and equipment The regulatory body should make it mandatory to evaluate and...
- 4
- 542
- 0
báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx
... (PHQ-scores), and HSU were made by ANCOVAs adjusted for covariates that may have substantial influence such as age, disease duration, comorbidities and QoL (AIMS2-SF scales assessing pain, physical limitation ... covariates as mentioned above More than a quarter of the patients received some acupuncture during the last half year and nearly a quarter visited a traditional healer at least once ANCOVAs revealed ... findings is that no control group was available Regarding pain medication, Paracetamol, which is the first choice treatment according to most guidelines, was only marginally prescribed The main...
- 9
- 413
- 0
Báo cáo toán học: " System for fast lexical and phonetic spoken term detection in a Czech cultural heritage archive" docx
... trigram language model described in Section 3.3 and clustered DT adapted acoustic models that are automatically gradually adapted to each individual speaker This unsupervised iterative speaker adaptation ... rare personal and place names and just as they are underrepresented in the language model training data, they are also very important to the searchers Page of 11 of the collection [28] (in fact, ... emotional and contains many disfluences and non-speech events such as crying or whimpering The speaking rate also varies greatly depending on the speaker, which again is frequently an issue related...
- 11
- 377
- 0
Báo cáo hóa học: " Steinfield, H., Mooney, H.A., Schneider, F. and Neville, L. E. Livestock in a changing landscape: Drivers" pptx
... as milk and eggs, is far larger in the rural areas than in the urban areas General increases in production over the years, particularly with regard to poultry, are highlighted The Indian data ... management Regulatory systems with a regional approach, including utilization of animal wastes and increased storage time, are advocated The policy regarding nutrient loads is aimed at increasing the ... production takes place The shrinking communal resource base has forced a shift in animal farming in favour of small ruminants The limited grazing areas are placed under greater pressure as extensive...
- 7
- 241
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25